Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Schematic of CRISPR/Cas9-mediated PLXNB2 knockout (KO) with small guide (sg) RNA targeting second coding exon. (B) Western blots show Plexin-B2 expression in different SD2 GSCs, with β-actin as loading control. Note Plexin-B2 precursor at 240 kDa and mature form at 170 kDa. (C) IF images show Plexin-B2 expression in different SD2 GSCs, with Hoechst nuclear counterstain. (D) Left, schematic of atomic force microscopy (AFM) indentation method to probe cell stiffness by cantilever deflection. Middle, AFM indentation curves of different SD2 GSCs; right, box plots of cell stiffness, showing 25– 75% quartiles, median (line), and mean (plus sign). n= 6 cells per group. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (E) Left, depiction of membrane tension measurement with optical tweezers. Middle, force measurements during tether extrusion (shaded box). Right, quantifications of tether extrusion forces. n=5 cells per group. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (F) Left, schematic of FLIM of cell membranes labeled with Flipper-TR membrane dye, with low and high membrane tension associated with shorter and longer lifetimes, respectively. Middle top, representative FLIM images, with lifetime heatmap shown on right. Middle bottom, images show similar fluorescence intensities of Flipper-TR dye in WT and PB2 KO cells. Right top, violin plots show fluorescence lifetime from 3 images per group. Two-sided unpaired t-test. Right bottom, phasor plots of FLIM image data, with arrow indicating a shift to shorter lifetime values for PB2 KO cells. (G) Model of Plexin-B2 regulation of cortical contractility and membrane tension. Phalloidin staining show differences of F-actin network in WT and PB2 KO SD2 GSCs. DAPI for nuclear staining. Arrows point to stress fibers and spread-out contours of the WT GSCs.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: CRISPR, Knock-Out, Western Blot, Expressing, Control, Microscopy, Membrane, Labeling, Fluorescence, Staining

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Top, timeline for dextran uptake assay. Bottom, live-cell imaging of WT and PB2 KO SD2 GSCs labeled with SPY-Actin and exposed to dextran-Alexa488. Enlarged images of boxed areas are shown below. Quantification of the areas of dextran + clusters per cell are shown in box plots, with 25–75% quartiles, median (line), and mean (plus sign). n=85 cells for WT, n=44 cells for PB2 KO. Mann–Whitney–Wilcoxon test. (B) Top, live cell confocal plane images of WT and PB2 KO GSCs with side views of z-stacks showing intracellular localization of diffuse dextran-Alexa 488 signals in PB2 KO cells in addition to dextran endosome signals. In contrast, WT cells contained only dextran + endosomes. Bottom, histograms show fluorescence profiles showing bimodal distribution of dextran-Alexa 488 fluorescence intensities in PB2 KO GSCs (blue and brown arrows). n=177 cells for WT, n=161 cells for PB2 KO. Mann–Whitney–Wilcoxon test. (C, D) Left, schematic of myr-palm-GFP or -CFP attached to inner membrane leaflet. Right, live cell fluorescence imaging at 72 hr after transfection shows internalization of myr-palm-GFP or -CPF on endomembranes (arrow) in WT GSCs, in contrast to membrane retention of the probes (arrowhead) in PB2 KO GSCs. (E) Left, schematic of TauSTED super-resolution microscopy of GSCs labeled with MemGlow. Middle, TauSTED live-cell images show reduced endosomes (arrowheads) in PB2 KO cells compared to WT. Right, box plots show areas of MemGlow clusters in each cell. n=26 cells for WT, n=13 cells for PB2 KO. Two-sided unpaired t-test. (F) Working model of regulation of cortical and membrane tension by Plexin-B2, affecting endocytosis and membrane permeability in GSCs.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: Live Cell Imaging, Labeling, MANN-WHITNEY, Fluorescence, Membrane, Imaging, Transfection, Super-Resolution Microscopy, Permeability

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Left, schematic of PH(PLCδ1)-GFP PIP2 probe. Right, live-cell imaging at 72 hr post transfection reveals that the PH(PLCδ1)-GFP probes were largely internalized in WT GSCs (arrow), but retained on membrane of PB2 KO GSCs (arrowhead). (B) Left, still images of videography show accumulation of the PH(PLCδ1)-GFP probes (arrow) in front of the nucleus (NucSpot) of migrating WT SD2 GSCs in tunnels, more so in 3 than 8 µm tunnel, but not in PB2 KO cells. Dashed lines delineate cell boundary. Long arrow denotes direction of migration. Right, quantifications of the ratio of PH(PLCδ1)-GFP fluorescence intensity at front vs. rear of GSCs during passage. n=13-16 cells per condition. One-way ANOVA followed by Tukey’s multiple comparison test. Data represent mean ± SEM. (C) Left, schematic of R(+8)-pre-GFP probe for negative surface charge of inner plasma membrane. Right, live-cell imaging at 72 hr post-transfection shows internalization of the probes (arrow) in WT GSCs, in contrast to the predominant membrane localization in PB2 KO GSCs (arrowhead). (D) Left, still images of videography show accumulation of the R(+8)-pre-GFP probes (arrow) at front zone of WT GSCs when traversing the 3 µm tunnel, but not in PB2 KO cells. Right, bar graphs show the ratio of R-pre-GFP fluorescence intensity at rear vs. front of GSCs when passing through tunnels. n=22 cells for WT, n=27 cells for PB2 KO. Mann–Whitney–Wilcoxon test. Data represent mean ± SEM. (E) Diagram illustrating voltage sensitive FluoVolt membrane dye, with fluorescent intensity quenched by voltage-sensitive electron transfer from electron-rich donor mediated by “molecular wire” in plasma membrane. (F) Left, FluoVolt live-cell imaging shows reduced FluoVolt fluorescent intensity in cell membrane of Plexin-B2 KO cells, consistent with higher negative charges of inner membrane. Right, box plots of membrane FluoVolt intensity. n=25 cells for WT, n=27 cells for PB2 KO. Two-sided unpaired t-test. Data represent mean ± SEM. (G) Left, still images from videography show higher FluoVolt fluorescent signals at rear zone (arrowhead) of WT GSCs when traversing tunnels, more so in 3 than 8 µm tunnel, but not in PB2 KO cells. Migration direction is denoted by long arrow. Right, bar graphs show the ratio of FluoVolt intensity at rear vs. front during confined migration. n=15 cells per group. One-way ANOVA followed by Tukey’s multiple comparison test. Data represent mean ± SEM. (H) Live-cell images and quantifications show the effects of constitutive active (CA) RAP1B-V12 or dominant-negative (DN) RAP1B-N17 on FluoVolt intensity in WT or PB2 KO GSCs. n=25 cells per group. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (I) Left, still images capture calcium localization (Fluo4-AM fluorescence, arrowhead) at the rear of WT GSCs when traversing tunnels, more so in 3 than 8 µm tunnel, but not in PB2 KO cells. Migration direction is denoted by long arrow. Right, bar graphs showing Fluo4-AM intensity ratio at rear vs. front in GSC during passage through tunnels. n=15-16 cells. One-way ANOVA followed by Tukey’s multiple comparison test. Data represent mean ± SEM. (J) Left, still images from videography show that calcium chelator BAPTA-AM disrupted the pattern of high FluoVolt signals at the rear of WT GSCs (arrowhead) during confined migration. Right, bar graphs show FluoVolt intensity ratio at rear vs. front of GSCs when traversing tunnels. n=21 cells for WT, n=16 cells for PB2 KO. Two-sided unpaired t-test. Data represent mean ± SEM. (K) Model of Plexin-B2 signaling affecting membrane surface charge and electric field during polarized confined migration, with PIP2 enrichment at cell front and Ca 2+ at rear zone, leading to asymmetry of FluoVolt and R(+8)-pre-GFP.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: Live Cell Imaging, Transfection, Membrane, Migration, Fluorescence, Comparison, Clinical Proteomics, MANN-WHITNEY, Dominant Negative Mutation

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Structure model of the extracellular domain of human Plexin-B2 show the locations of lock1 and lock2 mutations predicted to form disulfide bridges that lock the ring structure. (B) Western blots show absence of mature Plexin-B2 (170 kDa) in PB2 KO GSC, and expression of lock mutants in PB2 KO SD2 and SD3 GSCs. β-actin serves as a loading control. (C) Still images from videography show passage of GSCs (nuclei visualized by NucSpot) through microchannels with PB2 wildtype rescue construct but not lock mutants, nor PB2 with deletion of extracellular domain (dECTO). Chevrons point to 3 µm constrictions. (D) Box plots show velocity through constrictions, stalling time at constrictions, and sum of forward and backward movements, with 25–75% quartiles, minimal and maximal values (whiskers), median (line), and mean (cross). For velocity and sum of movements: n=17-20 cells per condition. For stalling time at constriction: n=14-28 cells per condition. One-way ANOVA followed by Dunnett’s multiple comparisons test. (E) Still images from videography show F-actin assembly (SPY-actin, arrowhead) at cell rear and MemGlow + endosomes (arrow) at cell front of SD3 GSCs with Plexin-B2 WT rescue but not mutant rescues when traversing 3 µm constrictions (chevrons). (F) Bar graphs showing fluorescence intensity ratio of SPY-actin and MemGlow at rear vs. front of GSCs during confined migration. n=10-18 cells per condition. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. Data represent mean ± SEM. (G) Model of Plexin-B2 signaling and mechano-electrical regulation of membrane tension and membrane surface charge during polarized confined migration. Regionalized enrichment of endocytosis/PIP2 at cell front and F-actin/Ca 2+ at rear zone lead to asymmetry of FluoVolt and R(+8)-pre-GFP membrane probes.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: Western Blot, Expressing, Control, Construct, Mutagenesis, Fluorescence, Migration, Membrane

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Crystal structure of the plexin A3 intracellular region reveals an autoinhibited conformation through active site sequestration

doi: 10.1073/pnas.0906923106

Figure Lengend Snippet: Interaction between the RBD and GAP domain. (A) Interface between the RBD and the GAP domain. The N-terminal linker (N-linker) and C-terminal linker (C-linker) are colored in green and cyan, respectively. (B) COS-7 cell collapse assays showing that mutations in the RBD/GAP interface abolish plexin-induced cell collapse. The percentages of collapse are average of three experiments. Error bars: standard deviations. Representative images of cells are shown and collapsed cells are marked with arrowheads. (C) In vivo axon guidance assay of the L1524G mutant in Drosophila plexin A. Increased expression of wild type (WT) plexin A induces axons to abnormally cross the midline of the central nervous system (arrowheads). Both truncation of the cytoplasmic domain (ΔCyto) and the L1524G mutation eliminate this effect. Genotypes: (Control) ELAV-GAL4,UAS:HA Plexin A/+; (WT) ELAV-GAL4,UAS:HA Plexin A/UAS:HA Plexin A; (ΔCyto) ELAV-GAL4, UAS:HA Plexin A/UAS: HA Plexin AΔCyto; (L1524G) ELAV-GAL4, UAS:HA Plexin A/UAS:HA Plexin A L1524G. ***P < 0.0005 by two-tailed Student's t test.

Article Snippet: Multiple independent transgenic fly lines containing these HA-tagged plexin A proteins were generated (BestGene, Inc.) and examined for expression and in vivo function using standard approaches.

Techniques: In Vivo, Mutagenesis, Expressing, Two Tailed Test

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Crystal structure of the plexin A3 intracellular region reveals an autoinhibited conformation through active site sequestration

doi: 10.1073/pnas.0906923106

Figure Lengend Snippet: Rnd1 alone does not induce conformational changes in plexin. (A) Superimposition of the plexin A3 intracellular domain, the plexin B1 intracellular domain (PDB ID: 3HM6), the plexin B1 RBD core (PDB ID: 2R2O), and the plexin B1 RBD core/Rnd1 complex (PDB ID: 2REX). (B) Detailed view of the Rho GTPase binding site in the structures of plexin A3 and the plexin B1 RBD/Rnd1 complex. (C) Sequence alignment of the Rho GTPase-binding region in plexins. Residues involved in Rho GTPase binding are highlighted with circles. The two brown circles indicate the two residues that are conserved in class A and B plexins, but different in class C and D plexins. The secondary structure elements are based on the plexin A3 structure. m, Murine; d, Drosophila.

Article Snippet: Multiple independent transgenic fly lines containing these HA-tagged plexin A proteins were generated (BestGene, Inc.) and examined for expression and in vivo function using standard approaches.

Techniques: Binding Assay, Sequencing

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Crystal structure of the plexin A3 intracellular region reveals an autoinhibited conformation through active site sequestration

doi: 10.1073/pnas.0906923106

Figure Lengend Snippet: Interaction between the N-terminal segment and the GAP domain. (A) Sequence alignment of the N-terminal segment of plexins. Residues making contacts with the GAP domain are highlighted with black circles. m, Murine; d, Drosophila. (B) Interactions between the GAP domain and the N-terminal segment. The three right panels are exploded views of the correspondingly numbered boxes in the left panel. Changes of view angles are indicated by the rotation axis on the top of each panel. (C) Mutational analyses of the interface between the N-terminal segment and the GAP domain in the COS-7 collapse assay. (D) Mutational analyses of the corresponding interface residues in Drosophila plexin A using the vivo axon guidance assay. Genotypes: (M1320R) ELAV-GAL4, UAS:HA Plexin A/UAS:HA Plexin A M1320R; (L1338R) ELAV-GAL4, UAS:HA Plexin A/UAS:HA Plexin A L1338R; and as in Fig. 3C. *P < 0.05; ***P < 0.001 by two-tailed Student's t test.

Article Snippet: Multiple independent transgenic fly lines containing these HA-tagged plexin A proteins were generated (BestGene, Inc.) and examined for expression and in vivo function using standard approaches.

Techniques: Sequencing, Two Tailed Test

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) IF showing loss of Plexin-B2 protein in PLXNB2 ⁻/⁻ hESCs. n = 5 independent cultures per condition; unpaired two-tailed t-test. Bar graphs represent mean ± SEM. b) At D9 of differentiation, PLXNB2 ⁻/⁻ cells displayed reduced cortical F-actin and pMLC2 compared with WT. n = 5 independent cultures per condition, two-tailed nested t-test. c) Phase-contrast (top) and IF (bottom) images at D9. PLXNB2 ⁻/⁻ cells formed elongated projections (arrows) and showed increased DCX with reduced PAX6 compared with WT. n = 10 fields across two independent cultures; unpaired two-tailed t-test. d) IF for TUJ1 and SOX2 at D9. PLXNB2 ⁻/⁻ cells showed increased TUJ1 and reduced SOX2. Each data point represents the mean of multiple fields of view from two independent cultures; two-tailed nested t-test. Bar graphs represent mean ± SEM. e) Schematic and representative IF images from epistasis analysis. Latrunculin A (LatA, 0.5 µM) reduced cortical F-actin and promoted neurite protrusions in WT cells, mimicking Plexin-B2 knockout. Conversely, jasplakinolide (JPK, 0.5 µM) stabilized F-actin and suppressed projections in PLXNB2 ⁻/⁻ cells, restoring SOX2 expression. n = 3 images per condition; one-way ANOVA with Tukey’s test. Bar graphs represent mean ± SEM. f) Live-cell imaging of D6 cells labeled with NucSpot, SPY-tubulin, and SPY-actin over 30 hours. WT cells progressively reinforced cortical F-actin without protrusions, whereas PLXNB2 -/- cells showed diminished cortical actin and long tubulin-based projections.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Two Tailed Test, Knock-Out, Expressing, Live Cell Imaging, Labeling

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) UMAP embedding of snRNA-seq data from D9 cells (n = 3 replicates per genotype). WT cells segregated into clusters enriched for radial glia (RG), neural progenitors (NPCs), and ESC-like states, whereas KO cells aligned with differentiated neuronal clusters. b) Feature plots showing expression of NPC and neuronal markers. c) Expression of representative marker genes across D9 subclusters. d) Volcano plot of differentially expressed genes (DEGs; PLXNB2 -/- vs. WT), with selected genes highlighted. e) Bubble plot of enriched pathways upregulated in D9 PLXNB2 ⁻/⁻ cells. f) ENRICHR GO enrichment analysis of DEGs for categories of biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Violin plots showing downregulation of actin cytoskeleton–associated genes in PLXNB2 -/- cells. h) Heatmap of DEGs grouped by functional categories, across three replicates per genotype. i) Ingenuity Pathway Analysis (IPA) network summary. Growth factor signaling pathways were broadly suppressed, while PTEN was activated in PLXNB2 ⁻/⁻ cells. j) Predicted upstream regulators (IPA) of DEGs in PLXNB2 ⁻/⁻ vs. WT cells. k) Developmental stage scoring against human cortex gene signatures (Velmeshev et al., 2023). D9 WT cells aligned with 2 nd -3 rd trimester profiles, whereas PLXNB2 ⁻/⁻ cells shifted toward postnatal signatures.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Expressing, Marker, Functional Assay, Protein-Protein interactions

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) Workflow for generating anti-Plexin-B2 (PB2) nanobodies (Nbs). Camelids were immunized with recombinant extracellular domain of human PB2 protein, followed by phage display to isolate high-affinity VHHs, which were fused to human Fc (hFc). b) Experimental design. VHH-Fc Nbs (10 μg/ml) were added one day before iN protocol. c) Representative images showing reduced cortical F-actin, increased DCX and TUJ1, and decreased SOX2 in D10 cells treated with two independent anti-PB2 Nbs compared with control or no Nb. d) Quantification of marker expression. Each dot represents the mean of a field of view. n = 5 cultures for each condition; one-way ANOVA with Dunnett’s multiple-comparison test. Bar graphs represent mean ± SEM.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Recombinant, Control, Marker, Expressing, Comparison

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) Standard forebrain and midbrain neuronal differentiation protocols. At D36, WT cells generated dense networks of TUJ1⁺ axon-bearing neurons, whereas PLXNB2 ⁻/⁻ cells displayed aberrant morphologies. b) Accelerated protocol. After passage at D9, cells were switched directly to maturation medium, bypassing the differentiation media step. By D18a, PLXNB2 ⁻/⁻ cells developed dense networks of TUJ1⁺ axon-bearing neurons, while WT cells retained progenitor-like morphology. c) IF comparison of neuronal markers and morphology in D36 WT (standard protocol) and D18a PLXNB2 ⁻/⁻ (accelerated protocol) cells. d) UMAP embedding of D18a PLXNB2⁻/⁻ and D36 WT iNs, showing segregation by genotype and forebrain vs. midbrain protocols. e) Feature plots showing shared neuronal markers across subclusters and genotypes. f) Transcriptional profiling revealed comparable expression of core neuronal/axonal markers between D36 WT and D18a PLXNB2 ⁻/⁻ cells, but lower expression of functional genes in the latter. g) Experimental timeline and IF images show co-culture of iNs with GFAP⁺ astrocyte lawns to promote maturation. h) Multi-electrode array (MEA) recordings. PLXNB2 ⁻/⁻ cells after maturation exhibited higher firing rates and synchrony index than WT cells (n = 6 cultures per condition; one-way ANOVA with Dunnett’s correction). Bar graphs represent mean ± SEM. i) Heatmap of epigenetic regulators shows convergent transcriptional shifts of D36 WT and D18a PLXNB2 ⁻/⁻ iNs relative to D9 WT cells. D9 PLXNB2 ⁻/⁻ cells already exhibited a similar shift, indicating accelerated epigenetic reprogramming. j) D9 PLXNB2 ⁻/⁻ cells showed elevated nuclear TET3 compared with D9 WT, reaching levels comparable to D36 WT. n = 5 fields from 2 independent experiments for each condition, nested one-way ANOVA with Tukey’s multiple-comparison test. k) D9 PLXNB2 ⁻/⁻ cells exhibited precocious expression of lamin A/C, similar to D36 WT and D18a PLXNB2 ⁻/⁻ iNs. l) Working model: Plexin-B2-mediated cortical tension act as a mechanical barrier alongside an epigenetic barrier to prevent precocious differentiation.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Generated, Comparison, Expressing, Functional Assay, Co-Culture Assay

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) IF of day 42 cerebral organoids shows broad Plexin-B2 expression in the ventricular zone (VZ; SOX2⁺) and cortical plate (CP), including FAM107A⁺ outer radial glia. b) IF of human fetal brain at 23 gestational weeks reveals broad Plexin-B2 expression in the SOX2⁺ germinal matrix and developing cortex, including FAM107A⁺ cells. c) Representative images and quantification of organoid diameters show reduced size in PLXNB2 ⁻/⁻ organoids (WT, n = 15; KO, n = 16). Bar graphs represent mean ± SEM; unpaired two-tailed Student’s t-test. d) Left, IF demonstrates loss of Plexin-B2 in d42 KO organoids. Right, Western blot confirms Plexin-B2 ablation, with β-actin as loading control. Quantification from n = 3 independent experiments. unpaired two-tailed Student’s t -test. e) Left, IF reveals disrupted architecture of KO organoids with shrinkage of SOX2 + VZ. Right, Western blot and heatmap show reduced SOX2 and increased TUJ1. n = 3 independent cultures per condition; unpaired two-tailed Student’s t-test. f) KO organoids exhibit expanded but disorganized DCX⁺ neuroblasts and reduced PAX6⁺ progenitors. g) Disrupted neuroepithelial organization in KO organoids, with diffuse β-catenin, N-cadherin, and reduced apical F-actin enrichment. h) WT organoids contain a dense apical ring of proliferating Ki67⁺/pH3⁺ cells, which was reduced and mislocalized in KO organoids. i) EdU pulse-chase assay design (30 min pulse, 24 h chase). KO organoids showed increased cell-cycle exit (i.e. fraction of Ki67⁻ cells among EdU⁺ cells). n = 6 fields from 3 independent organoids for each condition; unpaired two-tailed t-test. j) Model: Plexin-B2 maintains progenitor pool homeostasis by regulating the timing of neuronal differentiation. Loss of Plexin-B2 leads to premature cell-cycle exit, precocious neuronal differentiation, and progenitor depletion.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Expressing, Two Tailed Test, Western Blot, Control, Pulse Chase

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) UMAP embedding of snRNA-seq profiles from day 42 cerebral organoids (n = 3 replicates per genotype). EN, excitatory neurons; Mes, mesenchymal-like; Epen, ependymal-like; SCP, Schwann cell precursor/neural crest-like. b) Stacked bar plots show loss of RG (sc0) and expansion of subplate-like (sc3) and maturing EN (sc6) populations in PLXNB2 ⁻/⁻ organoids, reflecting accelerated neurogenesis and lineage imbalance. c) Dot plot showing expression of marker genes across annotated subclusters. d) Feature plots highlighting distinctive marker gene expression in WT vs. PLXNB2 ⁻/⁻ subclusters. e) Volcano plot of DEGs (adj. P < 0.05, log 2 FC > 1) with selected genes labeled. f) GO enrichment analysis of DEGs, grouped by biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Heatmap showing functional gene groups: WT organoids upregulated mature neuronal and synaptic genes, whereas PLXNB2 ⁻/⁻ organoids upregulated stromal/EMT-associated genes, indicating lineage instability and aberrant mesenchymal-like states. h) IPA network analysis revealed broad suppression of progenitor/neuronal regulatory pathways in KO organoids, with limited activation of developmental branching and stress-response regulators. i) Predicted upstream regulators of DEGs, including suppression of proliferation- and neurogenesis-associated TFs and activation of senescence and stress regulators. j) Transcriptome scoring against human cortical developmental signatures (Velmeshev et al., 2023) with WT organoid cells primarily aligning with 2 nd trimester signatures, whereas PLXNB2 ⁻/⁻ organoids also align with postnatal/adult signatures, indicating accelerated developmental age. k) Comparative IPA of PLXNB2 ⁻/⁻ vs. WT in D36 iNs and d42 organoids revealed convergent alterations in neuronal differentiation and brain morphology pathways, supporting both models for Plexin-B2-linked neurodevelopmental defects. l) Model: Plexin-B2 enforces a cortical mechanical barrier integrated with an epigenetic barrier to safeguard the timing of neuronal differentiation. Loss of Plexin-B2 lowers this barrier, leading to premature epigenetic reprogramming, accelerated neurogenesis, and lineage instability.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Expressing, Marker, Gene Expression, Labeling, Functional Assay, Activation Assay

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: Semaphorin 4A exerts a proangiogenic effect by enhancing vascular endothelial growth factor-A expression in macrophages.

doi: 10.4049/jimmunol.1101435

Figure Lengend Snippet: FIGURE 1. Sema4A expression is increased in activated human macrophages. (A) Real-time RT-PCR analysis using RNA from human macrophages exposed to IFN-g, LPS alone, or combined with IFN-g for 18 h. RQ values are compared with control untreated macrophages and are mean 6 SD of n = 3 donors for each condition. Sema4A enhanced macrophage migration via PlexinD1. (B) Human recombinant Sema4A (from 0 up to 100 nmol/l) increased the migration in Boyden’s chamber of human macrophages treated for 18 h with LPS and IFN-g in a dose-response curve with a peak at 50 nmol/l of Sema4A. Values are mean 6 SD of four independent experiments. (C) Human macrophages exposed for 18 h to LPS and IFN-g were incubated in the presence or not of 20 mg/ml of PlexinD1 or PlexinB2-blocking Abs or appropriate control Ig and allowed to migrate toward 50 nmol/l of recombinant Sema4A for 4 h. Values are mean 6 SD (n = 4 donors) of four independent experiments. (D) Human macrophages exposed for 18 h to LPS and IFN-g were incubated in the presence or not of 20 mg/ml of PlexinD1-blocking Ab or IgG and stimulated with 50 nmol/l of recombinant Sema3E and Sema4A for 4 h. Values are mean 6 SD (n = 4 donors) of four independent experiments. (E and F) Sema4A and Sema3E protein levels were analyzed by Western blot analysis of lysates of control or LPS- and IFN-g–treated human macrophages. The data shown are representative (n = 4 donors) of four independent experiments. (F) Relative levels of Sema4A and Sema3E protein expression normalized to b-tubulin. (G) Protein levels of Sema4A were measured by ELISA both in the supernatants and cell lysates of human macrophages exposed or not for 18 h to LPS and IFN-g (see Materials and Methods). Values are mean 6 SD (n = 4 donors) of four independent experiments. Ctrl, Control. **p , 0.01, ***p , 0.001.

Article Snippet: Upper wells were loaded with 50 ml cells alone or in the presence of 50 nmol/l recombinant Sema4A, 20 mg/ml rabbit antiPlexinD1 Ab (H-70, sc-67145; Santa Cruz Biotechnology), 20 mg/ml mouse anti-PlexinB2 Ab (MAB5329; R&D Systems), and 20 mg/ml IgG or IgG2A controls, respectively (DakoCytomation).

Techniques: Expressing, Quantitative RT-PCR, Control, Migration, Recombinant, Incubation, Blocking Assay, Western Blot, Enzyme-linked Immunosorbent Assay

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: Semaphorin 4A exerts a proangiogenic effect by enhancing vascular endothelial growth factor-A expression in macrophages.

doi: 10.4049/jimmunol.1101435

Figure Lengend Snippet: FIGURE 3. Sema4A and its receptors are modulated in macrophages and circulating inflammatory monocytes during peritoneal inflammation. (A) Sema4A expression on peritoneal macrophages at different time points after thioglycollate challenge was detected using F4/80-PE– and Sema4A-FITC– conjugated Abs in FACS analysis. Data are representative of n = 8 mice. (B) Coexpression of Sema4A with PlexinD1, PlexinB2, and TIM-2 on F4/80- positive peritoneal macrophages at different time points after thioglycollate challenge was investigated in FACS analysis by means of anti–Sema4A-FITC, anti–PlexinD1-allophycocyanin, anti–PlexinB2-APC, and anti–TIM-2-647 Abs, respectively. Data are representative of n = 8 mice. (C) PlexinD1, PlexinB2, and TIM-2 expression in peritoneal macrophages is expressed as mean (means 6 SD of n = 8 mice). (D and E) Western blot analysis using protein lysates of control or thioglycollate-treated C57/Bl6 mice peritoneal cells. (E) Relative levels of Sema4A protein expression normalized to b-tubulin. The data are representative of n = 12 mice analyzed. (F) Ly6Chigh and Ly6Clow monocyte subsets from the peripheral blood of control or thioglycollate-treated mice were isolated by staining with anti–CD11b-allophycocyanin, anti–CD115-PE, and biotinylated anti-Ly6c Abs, and Sema4A expression was detected by FACS analysis by using anti-Sema4A FITC Ab. Ly6Chigh monocytes expressed high amount of Sema4A compared with the Ly6Clow both in control and treated mice. Sema4A expression in circulating monocytes is expressed as median (means 6 SD of n = 4 mice). **p , 0.01, ***p , 0.001.

Article Snippet: Upper wells were loaded with 50 ml cells alone or in the presence of 50 nmol/l recombinant Sema4A, 20 mg/ml rabbit antiPlexinD1 Ab (H-70, sc-67145; Santa Cruz Biotechnology), 20 mg/ml mouse anti-PlexinB2 Ab (MAB5329; R&D Systems), and 20 mg/ml IgG or IgG2A controls, respectively (DakoCytomation).

Techniques: Expressing, Western Blot, Control, Isolation, Staining

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: Semaphorin 4A exerts a proangiogenic effect by enhancing vascular endothelial growth factor-A expression in macrophages.

doi: 10.4049/jimmunol.1101435

Figure Lengend Snippet: FIGURE 4. Sema4A induces a proangiogenic activity on human macrophages. (A) Real-time RT-PCR analysis using RNA from human macrophages treated for 18 h with human recombinant Sema4A (10, 50, and 100 nmol/l). RQ values are compared with control macrophages and are mean 6 SD of n = 4 donors for each condition. (B and C) VEGF-A protein levels were analyzed by Western blot analysis of lysates of human macrophages upon 18-h treatment with different concentrations of recombinant Sema4A (10, 50, and 100 nmol/l). The data shown are representative (n = 4 donors) of four independent experiments. (C) Relative levels of VEGF-A protein expression normalized to b-tubulin. (D) Protein levels of VEGF-A were measured by ELISA in the supernatants of human macrophages treated with 10, 50, and 100 nmol/l of human recombinant Sema4A. Values are mean 6 SD (n = 4 donors) of four independent experiments. (E and F) Protein levels of VEGF-A were measured by ELISA in the supernatants and lysates of human macrophages treated with 50 nmol/l of human recombinant Sema4A in the presence or not of PlexinD1 and PlexinB2-blocking Abs or LPS. Values are mean 6 SD (n = 4 donors) of four independent experiments. (G) Phospho–VEGFR-2 and phospho–VEGFR-1 protein levels were analyzed by Western blot analysis of lysates of human macrophages upon 18-h treatment with 50 nmol/l of recombinant Sema4A. The data shown are representative (n = 4 donors) of four independent experiments. **p , 0.01, ***p , 0.001.

Article Snippet: Upper wells were loaded with 50 ml cells alone or in the presence of 50 nmol/l recombinant Sema4A, 20 mg/ml rabbit antiPlexinD1 Ab (H-70, sc-67145; Santa Cruz Biotechnology), 20 mg/ml mouse anti-PlexinB2 Ab (MAB5329; R&D Systems), and 20 mg/ml IgG or IgG2A controls, respectively (DakoCytomation).

Techniques: Activity Assay, Quantitative RT-PCR, Recombinant, Control, Western Blot, Expressing, Enzyme-linked Immunosorbent Assay, Blocking Assay

Journal: Sarcoma

Article Title: Plexin-B2 and Semaphorins Do Not Drive Rhabdomyosarcoma Proliferation or Migration

doi: 10.1155/2022/9646909

Figure Lengend Snippet: IHC of Plexin-B2 and its ligands in TMAs. Representative immunohistochemistry staining images showing the expression of Plexin-B2 and its ligands SEMA4C, SEMA4D, and SEMA4F in rhabdomyosarcoma subtypes (aRMS and eRMS). Secondary antibody for each antibody is used as a negative control. Scale bar: 50 μ m.

Article Snippet: Primary antibodies used in this study are Plexin-B2 (R&D Systems, Cat. #AF5329; Abcam, Cat. #ab193355; Santa Cruz Biotechnology, Cat. #sc-373969), SEMA4C (Santa Cruz Biotechnology, Cat. #138445), SEMA4D (Abcam, Cat. #ab134128), SEMA4F (Santa Cruz Biotechnology, Cat. #125264), GAPDH (Cell Signaling Technology, Cat. #2118), and ß-actin (Cell Signaling Technology, Cat. #4790).

Techniques: Immunohistochemistry, Staining, Expressing, Negative Control

Journal: Sarcoma

Article Title: Plexin-B2 and Semaphorins Do Not Drive Rhabdomyosarcoma Proliferation or Migration

doi: 10.1155/2022/9646909

Figure Lengend Snippet: IHC analyses of Plexin-B2, SEMA4C, SEMA4D, and SEMA4F using TMA for RMS.

Article Snippet: Primary antibodies used in this study are Plexin-B2 (R&D Systems, Cat. #AF5329; Abcam, Cat. #ab193355; Santa Cruz Biotechnology, Cat. #sc-373969), SEMA4C (Santa Cruz Biotechnology, Cat. #138445), SEMA4D (Abcam, Cat. #ab134128), SEMA4F (Santa Cruz Biotechnology, Cat. #125264), GAPDH (Cell Signaling Technology, Cat. #2118), and ß-actin (Cell Signaling Technology, Cat. #4790).

Techniques: Staining

Journal: Sarcoma

Article Title: Plexin-B2 and Semaphorins Do Not Drive Rhabdomyosarcoma Proliferation or Migration

doi: 10.1155/2022/9646909

Figure Lengend Snippet: Robust expression of Plexin-B2 ligands. Immunoblot analyses of protein lysates of rhabdomyosarcoma cell lines, using the known ligands of Plexin-B2, i.e., SEMA4C, SEMA4D, and SEMA4F antibodies in panels (a), (b), and (c), respectively. SEMA4C is uniformly expressed between eRMS and aRMS cell lines. SEMA4D protein expression is increased in eRMS cell lines compared to aRMS cell lines. In contrast, SEMA4F protein expression is increased in aRMS cell lines compared to eRMS cell lines. GAPDH and ß-actin are used as loading controls.

Article Snippet: Primary antibodies used in this study are Plexin-B2 (R&D Systems, Cat. #AF5329; Abcam, Cat. #ab193355; Santa Cruz Biotechnology, Cat. #sc-373969), SEMA4C (Santa Cruz Biotechnology, Cat. #138445), SEMA4D (Abcam, Cat. #ab134128), SEMA4F (Santa Cruz Biotechnology, Cat. #125264), GAPDH (Cell Signaling Technology, Cat. #2118), and ß-actin (Cell Signaling Technology, Cat. #4790).

Techniques: Expressing, Western Blot

Journal: Sarcoma

Article Title: Plexin-B2 and Semaphorins Do Not Drive Rhabdomyosarcoma Proliferation or Migration

doi: 10.1155/2022/9646909

Figure Lengend Snippet: Efficient knockdown of Plexin-B2 siRNA in rhabdomyosarcoma. Plexin-B2 protein downregulation in selected eRMS and aRMS cell lines depicted by immunoblots. The cells were transfected with 25 picomoles of scrambled and Plexin-B2 siRNAs. Interestingly, the SEMA4C ligand expression is upregulated upon Plexin-B2 knockdown.

Article Snippet: Primary antibodies used in this study are Plexin-B2 (R&D Systems, Cat. #AF5329; Abcam, Cat. #ab193355; Santa Cruz Biotechnology, Cat. #sc-373969), SEMA4C (Santa Cruz Biotechnology, Cat. #138445), SEMA4D (Abcam, Cat. #ab134128), SEMA4F (Santa Cruz Biotechnology, Cat. #125264), GAPDH (Cell Signaling Technology, Cat. #2118), and ß-actin (Cell Signaling Technology, Cat. #4790).

Techniques: Knockdown, Western Blot, Transfection, Expressing

Journal: Sarcoma

Article Title: Plexin-B2 and Semaphorins Do Not Drive Rhabdomyosarcoma Proliferation or Migration

doi: 10.1155/2022/9646909

Figure Lengend Snippet: Effect of ligand stimulation in cell migration with and without serum. In a different xCELLigence instrument-based migration assay from the Boyden chamber assay in , eRMS and aRMS cell lines have minimal response to ligand stimulation. SEMA4C and SEMA4D ligand concentration = 200 ng/mL. (The data on graphs show means ± SEM. ∗ p < 0.05, ∗∗ p < 0.01. ∗∗∗ p < 0.001).

Article Snippet: Primary antibodies used in this study are Plexin-B2 (R&D Systems, Cat. #AF5329; Abcam, Cat. #ab193355; Santa Cruz Biotechnology, Cat. #sc-373969), SEMA4C (Santa Cruz Biotechnology, Cat. #138445), SEMA4D (Abcam, Cat. #ab134128), SEMA4F (Santa Cruz Biotechnology, Cat. #125264), GAPDH (Cell Signaling Technology, Cat. #2118), and ß-actin (Cell Signaling Technology, Cat. #4790).

Techniques: Migration, Boyden Chamber Assay, Concentration Assay